Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2930320..2930464 | Replicon | chromosome |
Accession | NZ_AP024281 | ||
Organism | Enterobacter asburiae strain Ent261 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2930326..2930429 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2930320..2930464 (+) |
Genomic Context
Location: 2925477..2926925 (1449 bp)
Type: Others
Protein ID: WP_197745876.1
Type: Others
Protein ID: WP_197745876.1
Location: 2927032..2927271 (240 bp)
Type: Others
Protein ID: WP_008500472.1
Type: Others
Protein ID: WP_008500472.1
Location: 2928117..2929058 (942 bp)
Type: Others
Protein ID: WP_033145838.1
Type: Others
Protein ID: WP_033145838.1
Location: 2929232..2930128 (897 bp)
Type: Others
Protein ID: WP_033145839.1
Type: Others
Protein ID: WP_033145839.1
Location: 2930320..2930464 (145 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2932302..2932532 (231 bp)
Type: Others
Protein ID: WP_008500465.1
Type: Others
Protein ID: WP_008500465.1
Location: 2932643..2933293 (651 bp)
Type: Others
Protein ID: WP_033145843.1
Type: Others
Protein ID: WP_033145843.1
Location: 2933318..2933980 (663 bp)
Type: Others
Protein ID: WP_010432611.1
Type: Others
Protein ID: WP_010432611.1
Location: 2927306..2927950 (645 bp)
Type: Others
Protein ID: WP_033145837.1
Type: Others
Protein ID: WP_033145837.1
Location: 2930326..2930429 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2930568..2930906 (339 bp)
Type: Others
Protein ID: WP_033145840.1
Type: Others
Protein ID: WP_033145840.1
Location: 2930923..2931792 (870 bp)
Type: Others
Protein ID: WP_033145841.1
Type: Others
Protein ID: WP_033145841.1
Location: 2931794..2932165 (372 bp)
Type: Others
Protein ID: WP_033145842.1
Type: Others
Protein ID: WP_033145842.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
R1N_RS14240 (R1N_28080) | 2925477..2926925 | + | 1449 | WP_197745876.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
R1N_RS14245 (R1N_28090) | 2927032..2927271 | + | 240 | WP_008500472.1 | YebV family protein | - |
R1N_RS14250 (R1N_28100) | 2927306..2927950 | - | 645 | WP_033145837.1 | protein-serine/threonine phosphatase | - |
R1N_RS14255 (R1N_28110) | 2928117..2929058 | + | 942 | WP_033145838.1 | VirK/YbjX family protein | - |
R1N_RS14260 (R1N_28120) | 2929232..2930128 | + | 897 | WP_033145839.1 | benzoate transporter | - |
- | 2930320..2930464 | + | 145 | - | - | Antitoxin |
- | 2930326..2930429 | - | 104 | - | - | Toxin |
R1N_RS14265 (R1N_28130) | 2930568..2930906 | - | 339 | WP_033145840.1 | YebY family protein | - |
R1N_RS14270 (R1N_28140) | 2930923..2931792 | - | 870 | WP_033145841.1 | copper homeostasis membrane protein CopD | - |
R1N_RS14275 (R1N_28150) | 2931794..2932165 | - | 372 | WP_033145842.1 | CopC domain-containing protein YobA | - |
R1N_RS14280 (R1N_28160) | 2932302..2932532 | + | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
R1N_RS14285 (R1N_28170) | 2932643..2933293 | + | 651 | WP_033145843.1 | carbon-nitrogen hydrolase family protein | - |
R1N_RS14290 (R1N_28180) | 2933318..2933980 | + | 663 | WP_010432611.1 | exodeoxyribonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T38295 NZ_AP024281:c2930429-2930326 [Enterobacter asburiae]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT38295 NZ_AP024281:2930320-2930464 [Enterobacter asburiae]
ACAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
ACAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT