Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2122775..2122918 | Replicon | chromosome |
Accession | NZ_AP022486 | ||
Organism | Citrobacter portucalensis strain STN0717-27 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2122810..2122913 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2122775..2122918 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JLF36_RS10110 | 2119222..2119884 | - | 663 | WP_003833802.1 | exodeoxyribonuclease X | - |
JLF36_RS10115 | 2119908..2120564 | - | 657 | WP_003833801.1 | carbon-nitrogen hydrolase family protein | - |
JLF36_RS10120 | 2120671..2120901 | - | 231 | WP_003833800.1 | DNA polymerase III subunit theta | - |
JLF36_RS10125 | 2121045..2121419 | + | 375 | WP_003833799.1 | CopC domain-containing protein YobA | - |
JLF36_RS10130 | 2121423..2122295 | + | 873 | WP_003833795.1 | copper homeostasis membrane protein CopD | - |
JLF36_RS10135 | 2122316..2122654 | + | 339 | WP_003833793.1 | YebY family protein | - |
- | 2122775..2122918 | - | 144 | - | - | Antitoxin |
- | 2122810..2122913 | + | 104 | - | - | Toxin |
JLF36_RS10140 | 2122991..2124076 | - | 1086 | WP_153752806.1 | phage integrase Arm DNA-binding domain-containing protein | - |
JLF36_RS10145 | 2124045..2124317 | - | 273 | WP_016156226.1 | hypothetical protein | - |
JLF36_RS10150 | 2124382..2124624 | - | 243 | WP_003841647.1 | DUF4060 family protein | - |
JLF36_RS10155 | 2124611..2124814 | - | 204 | WP_200921464.1 | hypothetical protein | - |
JLF36_RS10160 | 2124807..2125151 | - | 345 | WP_054528498.1 | hypothetical protein | - |
JLF36_RS10165 | 2125186..2126271 | - | 1086 | WP_200921465.1 | recombinase RecT | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2117153..2189110 | 71957 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T35778 NZ_AP022486:2122810-2122913 [Citrobacter portucalensis]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT35778 NZ_AP022486:c2122918-2122775 [Citrobacter portucalensis]
CACATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
CACATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT