Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1958070..1958217 | Replicon | chromosome |
Accession | NZ_AP022412 | ||
Organism | Klebsiella quasipneumoniae strain STW0522-39 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1958111..1958213 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1958070..1958217 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JLF46_RS09580 | 1954168..1954827 | - | 660 | WP_004203387.1 | exodeoxyribonuclease X | - |
JLF46_RS09585 | 1954906..1955136 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
JLF46_RS09590 | 1955243..1956331 | + | 1089 | WP_200927913.1 | IS481 family transposase | - |
JLF46_RS09595 | 1956350..1956724 | + | 375 | WP_194417786.1 | CopC domain-containing protein YobA | - |
JLF46_RS09600 | 1956728..1957597 | + | 870 | WP_004203385.1 | copper homeostasis membrane protein CopD | - |
JLF46_RS09605 | 1957614..1957952 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1958070..1958217 | - | 148 | - | - | Antitoxin |
- | 1958111..1958213 | + | 103 | - | - | Toxin |
JLF46_RS09610 | 1958601..1958744 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
JLF46_RS09615 | 1958848..1959816 | - | 969 | WP_004203383.1 | VirK/YbjX family protein | - |
JLF46_RS09620 | 1959973..1960626 | + | 654 | WP_099441356.1 | protein-serine/threonine phosphatase | - |
JLF46_RS09625 | 1960623..1960814 | - | 192 | WP_002911395.1 | YebW family protein | - |
JLF46_RS09630 | 1960912..1961151 | - | 240 | WP_002911393.1 | YebV family protein | - |
JLF46_RS09635 | 1961268..1962701 | - | 1434 | WP_200927914.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1952137..1965463 | 13326 | |
- | flank | IS/Tn | - | - | 1955243..1956331 | 1088 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T35622 NZ_AP022412:1958111-1958213 [Klebsiella quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT35622 NZ_AP022412:c1958217-1958070 [Klebsiella quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG