Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1971228..1971368 | Replicon | chromosome |
Accession | NZ_AP021873 | ||
Organism | Serratia marcescens strain ATCC 274 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1971272..1971368 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1971228..1971368 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SMATCC274_RS09365 | 1966497..1966892 | + | 396 | WP_048322942.1 | RidA family protein | - |
SMATCC274_RS09370 | 1967049..1968002 | + | 954 | WP_033641435.1 | prolyl aminopeptidase | - |
SMATCC274_RS09375 | 1968034..1968264 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
SMATCC274_RS09380 | 1968609..1969127 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
SMATCC274_RS09385 | 1969419..1969835 | + | 417 | WP_042706245.1 | CopC domain-containing protein YobA | - |
SMATCC274_RS09390 | 1969838..1970719 | + | 882 | WP_048797011.1 | copper homeostasis membrane protein CopD | - |
SMATCC274_RS09395 | 1970789..1971130 | + | 342 | WP_016928154.1 | YebY family protein | - |
- | 1971228..1971368 | - | 141 | - | - | Antitoxin |
- | 1971272..1971368 | + | 97 | - | - | Toxin |
SMATCC274_RS09400 | 1971620..1972024 | + | 405 | WP_161544608.1 | hypothetical protein | - |
SMATCC274_RS09405 | 1972021..1972239 | - | 219 | WP_033640661.1 | hypothetical protein | - |
SMATCC274_RS09410 | 1972314..1972664 | - | 351 | WP_033640660.1 | hypothetical protein | - |
SMATCC274_RS09415 | 1972913..1973263 | + | 351 | WP_033640658.1 | DUF4377 domain-containing protein | - |
SMATCC274_RS09420 | 1973447..1974646 | + | 1200 | WP_161544609.1 | trans-2-enoyl-CoA reductase family protein | - |
SMATCC274_RS09425 | 1974873..1975091 | + | 219 | WP_033640657.1 | hypothetical protein | - |
SMATCC274_RS09430 | 1975263..1975568 | + | 306 | WP_016928132.1 | hypothetical protein | - |
SMATCC274_RS09435 | 1975617..1975952 | + | 336 | WP_016928131.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T33397 NZ_AP021873:1971272-1971368 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT33397 NZ_AP021873:c1971368-1971228 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG