Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1969307..1969447 | Replicon | chromosome |
Accession | NZ_AP019009 | ||
Organism | Serratia marcescens strain AS-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1969351..1969447 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1969307..1969447 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SERAS_RS09405 | 1964575..1964970 | + | 396 | WP_097102344.1 | RidA family protein | - |
SERAS_RS09410 | 1965127..1966080 | + | 954 | WP_004928848.1 | prolyl aminopeptidase | - |
SERAS_RS09415 | 1966112..1966342 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
SERAS_RS09420 | 1966687..1967205 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
SERAS_RS09425 | 1967498..1967914 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
SERAS_RS09430 | 1967917..1968798 | + | 882 | WP_116403893.1 | copper homeostasis membrane protein CopD | - |
SERAS_RS09435 | 1968868..1969209 | + | 342 | WP_004940890.1 | YebY family protein | - |
- | 1969307..1969447 | - | 141 | - | - | Antitoxin |
- | 1969351..1969447 | + | 97 | - | - | Toxin |
SERAS_RS09445 | 1969885..1970400 | + | 516 | WP_117286890.1 | hypothetical protein | - |
SERAS_RS09450 | 1970540..1971210 | + | 671 | Protein_1815 | hypothetical protein | - |
SERAS_RS09455 | 1971788..1972441 | - | 654 | WP_016928140.1 | hypothetical protein | - |
SERAS_RS09460 | 1972725..1973129 | + | 405 | WP_079451355.1 | hypothetical protein | - |
SERAS_RS09465 | 1973126..1973344 | - | 219 | WP_117286889.1 | hypothetical protein | - |
SERAS_RS09470 | 1973419..1973769 | - | 351 | WP_033640660.1 | hypothetical protein | - |
SERAS_RS09475 | 1974018..1974368 | + | 351 | WP_004940949.1 | DUF4377 domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T32497 NZ_AP019009:1969351-1969447 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT32497 NZ_AP019009:c1969447-1969307 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG