Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3673218..3673366 | Replicon | chromosome |
Accession | NZ_AP018756 | ||
Organism | Metakosakonia sp. MRY16-398 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3673218..3673320 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3673218..3673366 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MRY16398_RS18045 | 3668378..3668713 | + | 336 | WP_047369725.1 | hypothetical protein | - |
MRY16398_RS18050 | 3668717..3669067 | + | 351 | WP_172600638.1 | Rrf2 family transcriptional regulator | - |
MRY16398_RS18055 | 3669206..3671713 | + | 2508 | WP_125124957.1 | exonuclease | - |
MRY16398_RS18060 | 3671778..3672050 | + | 273 | WP_107222989.1 | excisionase | - |
MRY16398_RS18065 | 3672025..3673131 | + | 1107 | WP_125124958.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 3673218..3673320 | - | 103 | - | - | Toxin |
- | 3673218..3673366 | + | 149 | - | - | Antitoxin |
MRY16398_RS18070 | 3673477..3673818 | - | 342 | WP_107222991.1 | YebY family protein | - |
MRY16398_RS18075 | 3673833..3674702 | - | 870 | WP_079496722.1 | copper homeostasis membrane protein CopD | - |
MRY16398_RS18080 | 3674704..3675078 | - | 375 | WP_071195198.1 | CopC domain-containing protein YobA | - |
MRY16398_RS18085 | 3675216..3675446 | + | 231 | WP_039078743.1 | DNA polymerase III subunit theta | - |
MRY16398_RS18090 | 3675443..3676120 | + | 678 | WP_125124959.1 | exodeoxyribonuclease X | - |
MRY16398_RS18095 | 3676117..3678177 | - | 2061 | WP_125124960.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | - | gtrB / hsiC1/vipB / hsiB1/vipA / flhA / cheZ / cheY / cheB / cheR / cheW / cheA / motB / motA / flhC / flhD | 3469494..3787215 | 317721 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T32073 NZ_AP018756:c3673320-3673218 [Metakosakonia sp. MRY16-398]
GCATGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTTTTTTT
GCATGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 149 bp
>AT32073 NZ_AP018756:3673218-3673366 [Metakosakonia sp. MRY16-398]
AAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TAATGCAGGCTAAGTCGCCATGCACTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCGGCAAA
AAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TAATGCAGGCTAAGTCGCCATGCACTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCGGCAAA