Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1695979..1696124 | Replicon | chromosome |
Accession | NZ_AP018753 | ||
Organism | Klebsiella pneumoniae strain KP67 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1696015..1696117 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1695979..1696124 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
D5075_RS08565 | 1691109..1693169 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
D5075_RS08570 | 1693173..1693832 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
D5075_RS08575 | 1693911..1694141 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
D5075_RS08580 | 1694254..1694628 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
D5075_RS08585 | 1694632..1695501 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
D5075_RS08590 | 1695518..1695856 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1695979..1696124 | - | 146 | - | - | Antitoxin |
- | 1696015..1696117 | + | 103 | - | - | Toxin |
D5075_RS28725 | 1696493..1696636 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
D5075_RS08600 | 1696741..1697709 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
D5075_RS08605 | 1697866..1698519 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
D5075_RS08610 | 1698516..1698707 | - | 192 | WP_002911395.1 | YebW family protein | - |
D5075_RS08615 | 1698805..1699044 | - | 240 | WP_002911393.1 | YebV family protein | - |
D5075_RS08620 | 1699160..1700593 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1622924..1709195 | 86271 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T32049 NZ_AP018753:1696015-1696117 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT32049 NZ_AP018753:c1696124-1695979 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT