Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1015572..1015715 | Replicon | chromosome |
Accession | NZ_OX442412 | ||
Organism | Salmonella enterica subsp. enterica serovar Rissen isolate pure strain |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1015574..1015677 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1015572..1015715 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QM550_RS05115 | 1011004..1011273 | + | 270 | WP_077908593.1 | hypothetical protein | - |
QM550_RS05120 | 1011439..1011579 | + | 141 | WP_001576018.1 | hypothetical protein | - |
QM550_RS05125 | 1011725..1012266 | - | 542 | Protein_1007 | transposase | - |
QM550_RS05130 | 1012286..1012378 | - | 93 | WP_231923105.1 | hypothetical protein | - |
QM550_RS05135 | 1012408..1014828 | - | 2421 | WP_024149295.1 | type III secretion system effector SspH3 | - |
QM550_RS05140 | 1015001..1015084 | - | 84 | Protein_1010 | phage tail protein | - |
QM550_RS05145 | 1015096..1015443 | + | 348 | Protein_1011 | tyrosine-type recombinase/integrase | - |
- | 1015572..1015715 | + | 144 | - | - | Antitoxin |
- | 1015574..1015677 | - | 104 | - | - | Toxin |
QM550_RS05150 | 1015817..1016170 | - | 354 | WP_000722368.1 | YebY family protein | - |
QM550_RS05155 | 1016187..1017062 | - | 876 | WP_023137953.1 | copper homeostasis membrane protein CopD | - |
QM550_RS05160 | 1017063..1017437 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
QM550_RS05165 | 1017575..1017805 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
QM550_RS05170 | 1017913..1018569 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
QM550_RS05175 | 1018593..1019291 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T296959 NZ_OX442412:c1015677-1015574 [Salmonella enterica subsp. enterica serovar Rissen]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT296959 NZ_OX442412:1015572-1015715 [Salmonella enterica subsp. enterica serovar Rissen]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG