Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2197082..2197224 | Replicon | chromosome |
Accession | NZ_OW967518 | ||
Organism | Klebsiella oxytoca isolate |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2197117..2197220 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2197082..2197224 (-) |
Genomic Context
Location: 2192186..2194246 (2061 bp)
Type: Others
Protein ID: WP_016808307.1
Type: Others
Protein ID: WP_016808307.1
Location: 2195357..2195731 (375 bp)
Type: Others
Protein ID: WP_024274401.1
Type: Others
Protein ID: WP_024274401.1
Location: 2195736..2196605 (870 bp)
Type: Others
Protein ID: WP_004103346.1
Type: Others
Protein ID: WP_004103346.1
Location: 2196622..2196960 (339 bp)
Type: Others
Protein ID: WP_004103344.1
Type: Others
Protein ID: WP_004103344.1
Location: 2197117..2197220 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2194253..2194912 (660 bp)
Type: Others
Protein ID: WP_004103360.1
Type: Others
Protein ID: WP_004103360.1
Location: 2194991..2195221 (231 bp)
Type: Others
Protein ID: WP_004103351.1
Type: Others
Protein ID: WP_004103351.1
Location: 2197082..2197224 (143 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2197298..2198383 (1086 bp)
Type: Others
Protein ID: WP_064351719.1
Type: Others
Protein ID: WP_064351719.1
Location: 2198352..2198624 (273 bp)
Type: Others
Protein ID: WP_049101843.1
Type: Others
Protein ID: WP_049101843.1
Location: 2198790..2199269 (480 bp)
Type: Others
Protein ID: WP_049101844.1
Type: Others
Protein ID: WP_049101844.1
Location: 2199462..2199660 (199 bp)
Type: Others
Protein ID: Protein_2060
Type: Others
Protein ID: Protein_2060
Location: 2199657..2200304 (648 bp)
Type: Others
Protein ID: WP_064351718.1
Type: Others
Protein ID: WP_064351718.1
Location: 2200301..2200501 (201 bp)
Type: Others
Protein ID: WP_064351717.1
Type: Others
Protein ID: WP_064351717.1
Location: 2200498..2200716 (219 bp)
Type: Others
Protein ID: WP_047721000.1
Type: Others
Protein ID: WP_047721000.1
Location: 2200713..2201369 (657 bp)
Type: Others
Protein ID: WP_064351716.1
Type: Others
Protein ID: WP_064351716.1
Location: 2201366..2201794 (429 bp)
Type: Others
Protein ID: WP_064351715.1
Type: Others
Protein ID: WP_064351715.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LQ214_RS10485 (AI2744V1_2031) | 2192186..2194246 | + | 2061 | WP_016808307.1 | oligopeptidase B | - |
LQ214_RS10490 (AI2744V1_2032) | 2194253..2194912 | - | 660 | WP_004103360.1 | exodeoxyribonuclease X | - |
LQ214_RS10495 (AI2744V1_2033) | 2194991..2195221 | - | 231 | WP_004103351.1 | DNA polymerase III subunit theta | - |
LQ214_RS10500 (AI2744V1_2034) | 2195357..2195731 | + | 375 | WP_024274401.1 | CopC domain-containing protein YobA | - |
LQ214_RS10505 (AI2744V1_2035) | 2195736..2196605 | + | 870 | WP_004103346.1 | copper homeostasis membrane protein CopD | - |
LQ214_RS10510 (AI2744V1_2036) | 2196622..2196960 | + | 339 | WP_004103344.1 | YebY family protein | - |
- | 2197082..2197224 | - | 143 | - | - | Antitoxin |
- | 2197117..2197220 | + | 104 | - | - | Toxin |
LQ214_RS10515 (AI2744V1_2037) | 2197298..2198383 | - | 1086 | WP_064351719.1 | tyrosine-type recombinase/integrase | - |
LQ214_RS10520 (AI2744V1_2038) | 2198352..2198624 | - | 273 | WP_049101843.1 | excisionase | - |
LQ214_RS10525 (AI2744V1_2039) | 2198790..2199269 | - | 480 | WP_049101844.1 | hypothetical protein | - |
LQ214_RS10530 | 2199462..2199660 | - | 199 | Protein_2060 | DUF1382 family protein | - |
LQ214_RS10535 (AI2744V1_2040) | 2199657..2200304 | - | 648 | WP_064351718.1 | hypothetical protein | - |
LQ214_RS10540 (AI2744V1_2041) | 2200301..2200501 | - | 201 | WP_064351717.1 | hypothetical protein | - |
LQ214_RS10545 (AI2744V1_2042) | 2200498..2200716 | - | 219 | WP_047721000.1 | hypothetical protein | - |
LQ214_RS10550 (AI2744V1_2043) | 2200713..2201369 | - | 657 | WP_064351716.1 | MT-A70 family methyltransferase | - |
LQ214_RS10555 (AI2744V1_2044) | 2201366..2201794 | - | 429 | WP_064351715.1 | hypothetical protein | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2192132..2255724 | 63592 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T295815 NZ_OW967518:2197117-2197220 [Klebsiella oxytoca]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTTTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTTTTTTT
Antitoxin
Download Length: 143 bp
>AT295815 NZ_OW967518:c2197224-2197082 [Klebsiella oxytoca]
AGATAAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCCTTATAAGAATAGTTTACCGTGTCAGGTTTTCCAGT
AGATAAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCCTTATAAGAATAGTTTACCGTGTCAGGTTTTCCAGT