Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2193844..2193986 | Replicon | chromosome |
Accession | NZ_OW848788 | ||
Organism | Citrobacter freundii isolate 112 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2193879..2193982 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2193844..2193986 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LQ087_RS10810 | 2190291..2190953 | - | 663 | WP_003841659.1 | exodeoxyribonuclease X | - |
LQ087_RS10815 | 2190977..2191633 | - | 657 | WP_046671220.1 | carbon-nitrogen hydrolase family protein | - |
LQ087_RS10820 | 2191740..2191970 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
LQ087_RS10825 | 2192114..2192488 | + | 375 | WP_230121916.1 | CopC domain-containing protein YobA | - |
LQ087_RS10830 | 2192492..2193364 | + | 873 | WP_048232225.1 | copper homeostasis membrane protein CopD | - |
LQ087_RS10835 | 2193385..2193723 | + | 339 | WP_003034934.1 | YebY family protein | - |
- | 2193844..2193986 | - | 143 | - | - | Antitoxin |
- | 2193879..2193982 | + | 104 | - | - | Toxin |
LQ087_RS10840 | 2194061..2195146 | - | 1086 | WP_019076535.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LQ087_RS10845 | 2195115..2195387 | - | 273 | WP_071684411.1 | excisionase | - |
LQ087_RS10850 | 2195451..2195693 | - | 243 | WP_137375969.1 | DUF4060 family protein | - |
LQ087_RS10855 | 2195690..2195884 | - | 195 | WP_016156723.1 | hypothetical protein | - |
LQ087_RS10860 | 2195877..2196221 | - | 345 | WP_230121917.1 | hypothetical protein | - |
LQ087_RS10865 | 2196256..2197368 | - | 1113 | WP_230122431.1 | RecT family recombinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2188222..2239054 | 50832 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T295552 NZ_OW848788:2193879-2193982 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 143 bp
>AT295552 NZ_OW848788:c2193986-2193844 [Citrobacter freundii]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT