Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1027667..1027810 | Replicon | chromosome |
Accession | NZ_OW706648 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain BRD948 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1027706..1027808 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1027667..1027810 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NBW98_RS04815 | 1024091..1024789 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
NBW98_RS04820 | 1024813..1025469 | - | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
NBW98_RS04825 | 1025577..1025807 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
NBW98_RS04830 | 1025945..1026319 | + | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
NBW98_RS04835 | 1026320..1027195 | + | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
NBW98_RS04840 | 1027212..1027565 | + | 354 | WP_000722366.1 | YebY family protein | - |
- | 1027667..1027810 | - | 144 | - | - | Antitoxin |
- | 1027706..1027808 | + | 103 | - | - | Toxin |
NBW98_RS04845 | 1027929..1028237 | - | 309 | Protein_948 | tyrosine-type recombinase/integrase | - |
NBW98_RS04850 | 1028236..1028597 | - | 362 | Protein_949 | recombinase RecT | - |
NBW98_RS04855 | 1028598..1028708 | + | 111 | Protein_950 | replication protein | - |
NBW98_RS04860 | 1028721..1029116 | + | 396 | Protein_951 | DUF977 family protein | - |
NBW98_RS04865 | 1029402..1030532 | - | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1022003..1046078 | 24075 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T295484 NZ_OW706648:1027706-1027808 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT295484 NZ_OW706648:c1027810-1027667 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG