Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2302989..2303132 | Replicon | chromosome |
Accession | NZ_OW704291 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain BRD948 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2302991..2303093 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2302989..2303132 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NBX00_RS11485 | 2300267..2301397 | + | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
NBX00_RS11490 | 2301683..2302078 | - | 396 | Protein_2248 | DUF977 family protein | - |
NBX00_RS11495 | 2302091..2302201 | - | 111 | Protein_2249 | replication protein | - |
NBX00_RS11500 | 2302202..2302563 | + | 362 | Protein_2250 | recombinase RecT | - |
NBX00_RS11505 | 2302562..2302870 | + | 309 | Protein_2251 | tyrosine-type recombinase/integrase | - |
- | 2302989..2303132 | + | 144 | - | - | Antitoxin |
- | 2302991..2303093 | - | 103 | - | - | Toxin |
NBX00_RS11510 | 2303234..2303587 | - | 354 | WP_000722366.1 | YebY family protein | - |
NBX00_RS11515 | 2303604..2304479 | - | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
NBX00_RS11520 | 2304480..2304854 | - | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
NBX00_RS11525 | 2304992..2305222 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
NBX00_RS11530 | 2305330..2305986 | + | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
NBX00_RS11535 | 2306010..2306708 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2302396..2308796 | 6400 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T295443 NZ_OW704291:c2303093-2302991 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT295443 NZ_OW704291:2302989-2303132 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG