Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1974613..1974756 | Replicon | chromosome |
Accession | NZ_OU943336 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain MDUST305 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1974652..1974754 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1974613..1974756 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
AEG13_RS09575 (SAMEA1964467_01930) | 1971037..1971735 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
AEG13_RS09580 (SAMEA1964467_01931) | 1971759..1972415 | - | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
AEG13_RS09585 (SAMEA1964467_01932) | 1972523..1972753 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
AEG13_RS09590 (SAMEA1964467_01933) | 1972891..1973265 | + | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
AEG13_RS09595 (SAMEA1964467_01934) | 1973266..1974141 | + | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
AEG13_RS09600 (SAMEA1964467_01935) | 1974158..1974511 | + | 354 | WP_000722366.1 | YebY family protein | - |
- | 1974613..1974756 | - | 144 | - | - | Antitoxin |
- | 1974652..1974754 | + | 103 | - | - | Toxin |
AEG13_RS09605 (SAMEA1964467_01936) | 1974875..1975183 | - | 309 | Protein_1877 | tyrosine-type recombinase/integrase | - |
AEG13_RS09610 | 1975182..1975543 | - | 362 | Protein_1878 | recombinase RecT | - |
AEG13_RS09615 | 1975544..1975654 | + | 111 | Protein_1879 | replication protein | - |
AEG13_RS09620 | 1975667..1976062 | + | 396 | Protein_1880 | DUF977 family protein | - |
AEG13_RS09625 (SAMEA1964467_01938) | 1976348..1977478 | - | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1952740..2005943 | 53203 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T294909 NZ_OU943336:1974652-1974754 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT294909 NZ_OU943336:c1974756-1974613 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG