Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 4757122..4757267 | Replicon | chromosome |
| Accession | NZ_LT991957 | ||
| Organism | Enterobacter cloacae complex sp. isolate C45 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 4757129..4757232 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 4757122..4757267 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DBR02_RS23350 | 4752149..4752646 | + | 498 | WP_058652700.1 | single-stranded DNA-binding protein SSB1 | - |
| DBR02_RS23355 | 4752672..4752893 | + | 222 | WP_058689413.1 | hypothetical protein | - |
| DBR02_RS23360 | 4752893..4753045 | + | 153 | WP_058689414.1 | DUF1317 family protein | - |
| DBR02_RS23365 | 4753042..4753707 | + | 666 | WP_107535592.1 | DNA methyltransferase | - |
| DBR02_RS23370 | 4753707..4753931 | + | 225 | WP_058689424.1 | hypothetical protein | - |
| DBR02_RS23380 | 4754247..4754516 | + | 270 | WP_107535593.1 | hypothetical protein | - |
| DBR02_RS23385 | 4754519..4754737 | + | 219 | WP_107535594.1 | TraR/DksA family transcriptional regulator | - |
| DBR02_RS23390 | 4754737..4755129 | + | 393 | WP_107535595.1 | DUF2591 family protein | - |
| DBR02_RS23395 | 4755107..4755346 | + | 240 | WP_058689421.1 | DUF4222 domain-containing protein | - |
| DBR02_RS23400 | 4755356..4755565 | + | 210 | WP_058689420.1 | hypothetical protein | - |
| DBR02_RS23405 | 4755725..4755997 | + | 273 | WP_023300430.1 | hypothetical protein | - |
| DBR02_RS23410 | 4755966..4757051 | + | 1086 | WP_063158908.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 4757122..4757267 | + | 146 | - | - | Antitoxin |
| - | 4757129..4757232 | - | 104 | - | - | Toxin |
| DBR02_RS23415 | 4757373..4757711 | - | 339 | WP_063868473.1 | YebY family protein | - |
| DBR02_RS23420 | 4757728..4758597 | - | 870 | WP_107535596.1 | copper homeostasis membrane protein CopD | - |
| DBR02_RS23425 | 4758599..4758970 | - | 372 | WP_107535597.1 | CopC domain-containing protein YobA | - |
| DBR02_RS23430 | 4759108..4759338 | + | 231 | WP_003859784.1 | DNA polymerase III subunit theta | - |
| DBR02_RS23435 | 4759450..4760100 | + | 651 | WP_107535598.1 | carbon-nitrogen hydrolase family protein | - |
| DBR02_RS23440 | 4760125..4760787 | + | 663 | WP_063450101.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T294000 NZ_LT991957:c4757232-4757129 [Enterobacter cloacae complex sp.]
GGCAAGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT294000 NZ_LT991957:4757122-4757267 [Enterobacter cloacae complex sp.]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTCAATCGCCTTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTCAATCGCCTTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGT
