Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1536581..1536726 | Replicon | chromosome |
Accession | NZ_LR890515 | ||
Organism | Klebsiella pneumoniae isolate INF281-sc-2280206 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1536588..1536690 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1536581..1536726 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JMX78_RS07700 | 1532112..1533545 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
JMX78_RS07705 | 1533661..1533900 | + | 240 | WP_002911393.1 | YebV family protein | - |
JMX78_RS07710 | 1533998..1534189 | + | 192 | WP_002911395.1 | YebW family protein | - |
JMX78_RS07715 | 1534186..1534839 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
JMX78_RS07720 | 1534996..1535964 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
JMX78_RS07725 | 1536069..1536212 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 1536581..1536726 | + | 146 | - | - | Antitoxin |
- | 1536588..1536690 | - | 103 | - | - | Toxin |
JMX78_RS07730 | 1536849..1537187 | - | 339 | WP_002911404.1 | YebY family protein | - |
JMX78_RS07735 | 1537204..1538073 | - | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
JMX78_RS07740 | 1538077..1538451 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
JMX78_RS07745 | 1538564..1538794 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
JMX78_RS07750 | 1538873..1539532 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
JMX78_RS07755 | 1539536..1541596 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1526697..1610878 | 84181 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T291253 NZ_LR890515:c1536690-1536588 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT291253 NZ_LR890515:1536581-1536726 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT