Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1865052..1865197 | Replicon | chromosome |
Accession | NZ_LR890277 | ||
Organism | Klebsiella pneumoniae isolate INF355-sc-2280185 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1865088..1865190 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1865052..1865197 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JMV94_RS09120 | 1860182..1862242 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
JMV94_RS09125 | 1862246..1862905 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
JMV94_RS09130 | 1862984..1863214 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
JMV94_RS09135 | 1863327..1863701 | + | 375 | WP_201524362.1 | CopC domain-containing protein YobA | - |
JMV94_RS09140 | 1863705..1864574 | + | 870 | WP_104158933.1 | copper homeostasis membrane protein CopD | - |
JMV94_RS09145 | 1864591..1864929 | + | 339 | WP_016529031.1 | YebY family protein | - |
- | 1865052..1865197 | - | 146 | - | - | Antitoxin |
- | 1865088..1865190 | + | 103 | - | - | Toxin |
JMV94_RS09150 | 1865567..1865707 | - | 141 | Protein_1784 | Ecr family regulatory small membrane protein | - |
JMV94_RS09155 | 1865812..1866780 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
JMV94_RS09160 | 1866937..1867590 | + | 654 | WP_020802220.1 | protein-serine/threonine phosphatase | - |
JMV94_RS09165 | 1867587..1867778 | - | 192 | WP_002911395.1 | YebW family protein | - |
JMV94_RS09170 | 1867876..1868115 | - | 240 | WP_002911393.1 | YebV family protein | - |
JMV94_RS09175 | 1868231..1869664 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1811366..1869619 | 58253 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T290464 NZ_LR890277:1865088-1865190 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT290464 NZ_LR890277:c1865197-1865052 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT