Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2072591..2072717 | Replicon | chromosome |
Accession | NZ_LR134494 | ||
Organism | Serratia quinivorans strain NCTC13188 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2072629..2072709 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2072591..2072717 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EL336_RS09910 | 2067612..2068037 | + | 426 | WP_012006363.1 | RNA polymerase-binding protein DksA | - |
EL336_RS09915 | 2068210..2069163 | + | 954 | WP_126501503.1 | prolyl aminopeptidase | - |
EL336_RS09920 | 2069345..2069575 | - | 231 | WP_012006365.1 | DNA polymerase III subunit theta | - |
EL336_RS09925 | 2069951..2070469 | + | 519 | WP_012006366.1 | non-heme ferritin | - |
EL336_RS09930 | 2070793..2071176 | + | 384 | WP_126501505.1 | CopC domain-containing protein YobA | - |
EL336_RS09935 | 2071180..2072061 | + | 882 | WP_126501507.1 | copper homeostasis membrane protein CopD | - |
EL336_RS09940 | 2072131..2072472 | + | 342 | WP_012006369.1 | YebY family protein | - |
- | 2072591..2072717 | - | 127 | - | - | Antitoxin |
- | 2072629..2072709 | + | 81 | - | - | Toxin |
EL336_RS09950 | 2072930..2074127 | + | 1198 | Protein_1907 | IS4 family transposase | - |
EL336_RS25455 | 2074174..2074377 | + | 204 | WP_167470756.1 | hypothetical protein | - |
EL336_RS09955 | 2074296..2074631 | + | 336 | Protein_1909 | DUF4113 domain-containing protein | - |
EL336_RS09960 | 2074689..2075918 | - | 1230 | WP_126501511.1 | hypothetical protein | - |
EL336_RS09965 | 2076306..2077019 | + | 714 | WP_126501513.1 | GNAT family N-acetyltransferase | - |
EL336_RS09970 | 2077149..2077715 | - | 567 | WP_126501515.1 | DUF4136 domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2066506..2113876 | 47370 | |
- | flank | IS/Tn | - | - | 2072963..2073862 | 899 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 81 bp
>T287967 NZ_LR134494:2072629-2072709 [Serratia quinivorans]
AATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCGGTCTTTTTT
T
AATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCGGTCTTTTTT
T
Antitoxin
Download Length: 127 bp
>AT287967 NZ_LR134494:c2072717-2072591 [Serratia quinivorans]
AACAGGTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTTTGTGCAAAGCTTGTTCAGCCGTGCACTTTAAGAGTAG
AACAGGTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAA
GTTGGCATTTTGTGCAAAGCTTGTTCAGCCGTGCACTTTAAGAGTAG