Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2013193..2013338 | Replicon | chromosome |
Accession | NZ_LR130548 | ||
Organism | Klebsiella pneumoniae strain KPC2 isolate KPC2 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2013229..2013331 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2013193..2013338 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EW042_RS10080 | 2008323..2010383 | + | 2061 | WP_032422099.1 | oligopeptidase B | - |
EW042_RS10085 | 2010387..2011046 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
EW042_RS10090 | 2011125..2011355 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
EW042_RS10095 | 2011468..2011842 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
EW042_RS10100 | 2011846..2012715 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
EW042_RS10105 | 2012732..2013070 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2013193..2013338 | - | 146 | - | - | Antitoxin |
- | 2013229..2013331 | + | 103 | - | - | Toxin |
EW042_RS28765 | 2013706..2013849 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
EW042_RS10115 | 2013954..2014922 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
EW042_RS10120 | 2015079..2015732 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
EW042_RS10125 | 2015729..2015920 | - | 192 | WP_002911395.1 | YebW family protein | - |
EW042_RS10130 | 2016018..2016257 | - | 240 | WP_002911393.1 | YebV family protein | - |
EW042_RS10135 | 2016373..2017806 | - | 1434 | WP_129753502.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T286384 NZ_LR130548:2013229-2013331 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT286384 NZ_LR130548:c2013338-2013193 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT