Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1888760..1888900 | Replicon | chromosome |
| Accession | NZ_LR130543 | ||
| Organism | Klebsiella variicola strain 04153260899A isolate 04153260899A | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1888796..1888898 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1888760..1888900 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| EW039_RS09280 | 1883890..1885950 | + | 2061 | WP_012541258.1 | oligopeptidase B | - |
| EW039_RS09285 | 1885954..1886613 | - | 660 | WP_022066251.1 | exodeoxyribonuclease X | - |
| EW039_RS09290 | 1886692..1886922 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
| EW039_RS09295 | 1887036..1887410 | + | 375 | WP_008804269.1 | CopC domain-containing protein YobA | - |
| EW039_RS09300 | 1887414..1888283 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
| EW039_RS09305 | 1888300..1888638 | + | 339 | WP_008804271.1 | YebY family protein | - |
| - | 1888760..1888900 | - | 141 | - | - | Antitoxin |
| - | 1888796..1888898 | + | 103 | - | - | Toxin |
| EW039_RS09310 | 1888976..1890061 | - | 1086 | WP_129678578.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| EW039_RS09315 | 1890030..1890302 | - | 273 | WP_129678579.1 | excisionase | - |
| EW039_RS26625 | 1890435..1890602 | - | 168 | WP_172601098.1 | hypothetical protein | - |
| EW039_RS09320 | 1890628..1891257 | - | 630 | WP_129678580.1 | Eac protein | - |
| EW039_RS09325 | 1891293..1892114 | - | 822 | WP_129678581.1 | hypothetical protein | - |
| EW039_RS09330 | 1892172..1892429 | - | 258 | WP_129678582.1 | DNA polymerase III subunit theta | - |
| EW039_RS09335 | 1892516..1892713 | - | 198 | WP_129678583.1 | hypothetical protein | - |
| EW039_RS09340 | 1892706..1893278 | - | 573 | WP_129678797.1 | DUF551 domain-containing protein | - |
| EW039_RS09345 | 1893533..1893745 | - | 213 | WP_004141386.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1883923..1956569 | 72646 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T286323 NZ_LR130543:1888796-1888898 [Klebsiella variicola]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT286323 NZ_LR130543:c1888900-1888760 [Klebsiella variicola]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
