Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2693006..2693151 | Replicon | chromosome |
Accession | NZ_CP126140 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain DSE06 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2693008..2693111 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2693006..2693151 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QNM21_RS13230 | 2688206..2688424 | - | 219 | WP_001524708.1 | hypothetical protein | - |
QNM21_RS13235 | 2688726..2688824 | - | 99 | WP_223151200.1 | hypothetical protein | - |
QNM21_RS13240 | 2689143..2691122 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
QNM21_RS13245 | 2691536..2691814 | + | 279 | WP_001575998.1 | excisionase | - |
QNM21_RS13250 | 2691789..2692868 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2693006..2693151 | + | 146 | - | - | Antitoxin |
- | 2693008..2693111 | - | 104 | - | - | Toxin |
QNM21_RS13255 | 2693251..2693604 | - | 354 | WP_000722370.1 | YebY family protein | - |
QNM21_RS13260 | 2693621..2694496 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
QNM21_RS13265 | 2694497..2694871 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
QNM21_RS13270 | 2695009..2695239 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
QNM21_RS13275 | 2695347..2696003 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
QNM21_RS13280 | 2696027..2696725 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sodCI | 2656978..2698813 | 41835 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T282681 NZ_CP126140:c2693111-2693008 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT282681 NZ_CP126140:2693006-2693151 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG