Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2026829..2026974 | Replicon | chromosome |
Accession | NC_018522 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae 1084 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2026865..2026967 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2026829..2026974 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
A79E_RS09615 | 2021958..2024018 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
A79E_RS09620 | 2024022..2024681 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
A79E_RS09625 | 2024760..2024991 | - | 232 | Protein_1868 | DNA polymerase III subunit theta | - |
A79E_RS09630 | 2025104..2025478 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
A79E_RS09635 | 2025482..2026351 | + | 870 | WP_014907333.1 | copper homeostasis membrane protein CopD | - |
A79E_RS09640 | 2026368..2026706 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2026829..2026974 | - | 146 | - | - | Antitoxin |
- | 2026865..2026967 | + | 103 | - | - | Toxin |
A79E_RS28425 | 2027341..2027484 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
A79E_RS09650 | 2027589..2028557 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
A79E_RS09655 | 2028714..2029367 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
A79E_RS09660 | 2029364..2029555 | - | 192 | WP_002911395.1 | YebW family protein | - |
A79E_RS09665 | 2029653..2029892 | - | 240 | WP_002911393.1 | YebV family protein | - |
A79E_RS09670 | 2030008..2031441 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T28204 NC_018522:2026865-2026967 [Klebsiella pneumoniae subsp. pneumoniae 1084]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT28204 NC_018522:c2026974-2026829 [Klebsiella pneumoniae subsp. pneumoniae 1084]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT