Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1995961..1996101 | Replicon | chromosome |
Accession | NZ_CP124754 | ||
Organism | Serratia sp. K-E0102 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1996005..1996101 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1995961..1996101 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SSARUM2_RS09550 (SSARUM2_001910) | 1991163..1991588 | + | 426 | WP_033653830.1 | RNA polymerase-binding protein DksA | - |
SSARUM2_RS09555 (SSARUM2_001911) | 1991781..1992734 | + | 954 | WP_033646426.1 | prolyl aminopeptidase | - |
SSARUM2_RS09560 (SSARUM2_001912) | 1992766..1992996 | - | 231 | WP_033642715.1 | DNA polymerase III subunit theta | - |
SSARUM2_RS09565 (SSARUM2_001913) | 1993342..1993860 | + | 519 | WP_025302449.1 | non-heme ferritin | - |
SSARUM2_RS09570 (SSARUM2_001914) | 1994185..1994568 | + | 384 | WP_004940886.1 | CopC domain-containing protein YobA | - |
SSARUM2_RS09575 (SSARUM2_001915) | 1994571..1995452 | + | 882 | WP_049234570.1 | copper homeostasis membrane protein CopD | - |
SSARUM2_RS09580 (SSARUM2_001916) | 1995522..1995863 | + | 342 | WP_025302452.1 | YebY family protein | - |
- | 1995961..1996101 | - | 141 | - | - | Antitoxin |
- | 1996005..1996101 | + | 97 | - | - | Toxin |
SSARUM2_RS09585 (SSARUM2_001917) | 1996180..1996682 | - | 503 | Protein_1845 | tyrosine-type recombinase/integrase | - |
SSARUM2_RS09590 (SSARUM2_001918) | 1996925..1997983 | + | 1059 | WP_060438793.1 | acyltransferase | - |
SSARUM2_RS09595 (SSARUM2_001919) | 1998611..1999018 | + | 408 | WP_226907360.1 | hypothetical protein | - |
SSARUM2_RS09600 (SSARUM2_001920) | 1999015..1999233 | - | 219 | WP_033638114.1 | hypothetical protein | - |
SSARUM2_RS09605 (SSARUM2_001921) | 1999307..1999651 | - | 345 | WP_060452851.1 | hypothetical protein | - |
SSARUM2_RS09610 (SSARUM2_001922) | 1999944..2000294 | + | 351 | WP_033638116.1 | DUF4377 domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T281208 NZ_CP124754:1996005-1996101 [Serratia sp. K-E0102]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT281208 NZ_CP124754:c1996101-1995961 [Serratia sp. K-E0102]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG