Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2030720..2030863 | Replicon | chromosome |
| Accession | NZ_CP123660 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain CVM N38232 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2030758..2030861 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2030720..2030863 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DE22_RS09745 | 2027144..2027842 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DE22_RS09750 | 2027866..2028522 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| DE22_RS09755 | 2028630..2028860 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DE22_RS09760 | 2028998..2029372 | + | 375 | WP_000168398.1 | CopC domain-containing protein YobA | - |
| DE22_RS09765 | 2029373..2030248 | + | 876 | WP_000979700.1 | copper homeostasis membrane protein CopD | - |
| DE22_RS09770 | 2030265..2030618 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2030720..2030863 | - | 144 | - | - | Antitoxin |
| - | 2030758..2030861 | + | 104 | - | - | Toxin |
| DE22_RS09775 | 2030992..2032071 | - | 1080 | WP_000078708.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| DE22_RS09780 | 2032052..2032324 | - | 273 | WP_031617245.1 | excisionase | - |
| DE22_RS09785 | 2032396..2032812 | - | 417 | WP_022630509.1 | hypothetical protein | - |
| DE22_RS09790 | 2032911..2033090 | - | 180 | WP_000276802.1 | DUF1187 family protein | - |
| DE22_RS09795 | 2033078..2033704 | - | 627 | WP_000069467.1 | hypothetical protein | - |
| DE22_RS09800 | 2033701..2034033 | - | 333 | WP_000066251.1 | hypothetical protein | - |
| DE22_RS09805 | 2034026..2034346 | - | 321 | WP_001033920.1 | hypothetical protein | - |
| DE22_RS09810 | 2034382..2035476 | - | 1095 | WP_000107768.1 | RecT family recombinase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sspH2 / sspH2 / sopE2 | 2025058..2115580 | 90522 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T279113 NZ_CP123660:2030758-2030861 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT279113 NZ_CP123660:c2030863-2030720 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
