Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2641809..2641954 | Replicon | chromosome |
Accession | NZ_CP122457 | ||
Organism | Salmonella enterica subsp. enterica strain TZ282 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2641811..2641914 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2641809..2641954 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QCX26_RS12745 | 2637731..2638126 | + | 396 | WP_000422885.1 | DUF1398 domain-containing protein | - |
QCX26_RS12750 | 2638454..2638930 | + | 477 | WP_023194965.1 | hypothetical protein | - |
QCX26_RS12755 | 2639319..2639738 | - | 420 | WP_023137951.1 | GNAT family N-acetyltransferase | - |
QCX26_RS12760 | 2640110..2640376 | + | 267 | WP_079984025.1 | hypothetical protein | - |
QCX26_RS12765 | 2640545..2640685 | + | 141 | WP_031607419.1 | hypothetical protein | - |
QCX26_RS12770 | 2640831..2641292 | - | 462 | Protein_2497 | transposase | - |
QCX26_RS12775 | 2641290..2641690 | + | 401 | Protein_2498 | tyrosine-type recombinase/integrase | - |
- | 2641809..2641954 | + | 146 | - | - | Antitoxin |
- | 2641811..2641914 | - | 104 | - | - | Toxin |
QCX26_RS12780 | 2642055..2642408 | - | 354 | WP_000722368.1 | YebY family protein | - |
QCX26_RS12785 | 2642425..2643300 | - | 876 | WP_283880153.1 | copper homeostasis membrane protein CopD | - |
QCX26_RS12790 | 2643301..2643675 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
QCX26_RS12795 | 2643813..2644043 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
QCX26_RS12800 | 2644151..2644807 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
QCX26_RS12805 | 2644831..2645529 | + | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 2632785..2647615 | 14830 | |
- | flank | IS/Tn | - | - | 2640831..2641271 | 440 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T276949 NZ_CP122457:c2641914-2641811 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT276949 NZ_CP122457:2641809-2641954 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG