Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2529188..2529331 | Replicon | chromosome |
| Accession | NZ_CP121297 | ||
| Organism | Salmonella enterica subsp. enterica strain KKP 1762 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2529190..2529293 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2529188..2529331 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P1N06_RS12400 | 2524587..2524715 | - | 129 | Protein_2409 | helix-turn-helix domain-containing protein | - |
| P1N06_RS12405 | 2525205..2525975 | + | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| P1N06_RS12410 | 2525971..2526159 | + | 189 | Protein_2411 | tail fiber assembly protein | - |
| P1N06_RS12415 | 2526411..2526596 | + | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| P1N06_RS12420 | 2526687..2526796 | - | 110 | Protein_2413 | tail fiber assembly protein | - |
| P1N06_RS12425 | 2526845..2527177 | - | 333 | WP_031607880.1 | DUF1353 domain-containing protein | - |
| P1N06_RS12430 | 2527283..2527816 | - | 534 | Protein_2415 | DUF4376 domain-containing protein | - |
| P1N06_RS12435 | 2527770..2528126 | - | 357 | WP_076737138.1 | hypothetical protein | - |
| P1N06_RS12440 | 2528217..2529059 | + | 843 | Protein_2417 | tyrosine-type recombinase/integrase | - |
| - | 2529188..2529331 | + | 144 | - | - | Antitoxin |
| - | 2529190..2529293 | - | 104 | - | - | Toxin |
| P1N06_RS12445 | 2529432..2529785 | - | 354 | WP_000722368.1 | YebY family protein | - |
| P1N06_RS12450 | 2529802..2530677 | - | 876 | WP_076737139.1 | copper homeostasis membrane protein CopD | - |
| P1N06_RS12455 | 2530678..2531052 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P1N06_RS12460 | 2531190..2531420 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P1N06_RS12465 | 2531528..2532184 | + | 657 | WP_023234150.1 | carbon-nitrogen hydrolase family protein | - |
| P1N06_RS12470 | 2532208..2532906 | + | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2484993..2534994 | 50001 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T276243 NZ_CP121297:c2529293-2529190 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT276243 NZ_CP121297:2529188-2529331 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
