Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 3454648..3454791 | Replicon | chromosome |
| Accession | NZ_CP121296 | ||
| Organism | Salmonella enterica subsp. enterica strain KKP 1213 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 3454686..3454789 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 3454648..3454791 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P1838_RS16490 | 3451073..3451771 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| P1838_RS16495 | 3451795..3452451 | - | 657 | WP_023234150.1 | carbon-nitrogen hydrolase family protein | - |
| P1838_RS16500 | 3452559..3452789 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P1838_RS16505 | 3452927..3453301 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P1838_RS16510 | 3453302..3454177 | + | 876 | WP_076737139.1 | copper homeostasis membrane protein CopD | - |
| P1838_RS16515 | 3454194..3454547 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 3454648..3454791 | - | 144 | - | - | Antitoxin |
| - | 3454686..3454789 | + | 104 | - | - | Toxin |
| P1838_RS16520 | 3454920..3455762 | - | 843 | Protein_3199 | tyrosine-type recombinase/integrase | - |
| P1838_RS16525 | 3455853..3456209 | + | 357 | WP_076737138.1 | hypothetical protein | - |
| P1838_RS16530 | 3456163..3456369 | + | 207 | Protein_3201 | phage tail protein | - |
| P1838_RS16535 | 3456454..3456696 | + | 243 | Protein_3202 | DUF4376 domain-containing protein | - |
| P1838_RS16540 | 3456802..3457134 | + | 333 | WP_031607880.1 | DUF1353 domain-containing protein | - |
| P1838_RS16545 | 3457183..3457292 | + | 110 | Protein_3204 | tail fiber assembly protein | - |
| P1838_RS16550 | 3457383..3457568 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| P1838_RS16555 | 3457820..3458008 | - | 189 | Protein_3206 | tail fiber assembly protein | - |
| P1838_RS16560 | 3458004..3458774 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| P1838_RS16565 | 3459264..3459392 | + | 129 | Protein_3208 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 3432776..3486058 | 53282 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T276233 NZ_CP121296:3454686-3454789 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT276233 NZ_CP121296:c3454791-3454648 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG