Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2297246..2297389 | Replicon | chromosome |
| Accession | NZ_CP121075 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R22.2574 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2297284..2297387 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2297246..2297389 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8I05_RS11005 | 2293670..2294368 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
| P8I05_RS11010 | 2294392..2295048 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P8I05_RS11015 | 2295156..2295386 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8I05_RS11020 | 2295524..2295898 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8I05_RS11025 | 2295899..2296774 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P8I05_RS11030 | 2296791..2297144 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2297246..2297389 | - | 144 | - | - | Antitoxin |
| - | 2297284..2297387 | + | 104 | - | - | Toxin |
| P8I05_RS11035 | 2297547..2298440 | - | 894 | Protein_2140 | tyrosine-type recombinase/integrase | - |
| P8I05_RS11040 | 2298704..2299165 | - | 462 | Protein_2141 | DNA breaking-rejoining protein | - |
| P8I05_RS11045 | 2299154..2299345 | + | 192 | Protein_2142 | glycoside hydrolase family 19 protein | - |
| P8I05_RS11050 | 2299399..2299932 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P8I05_RS11055 | 2300189..2300356 | - | 168 | WP_000789529.1 | lytic enzyme | - |
| P8I05_RS11060 | 2300664..2300924 | + | 261 | Protein_2145 | DUF1441 family protein | - |
| P8I05_RS11065 | 2300926..2301141 | + | 216 | Protein_2146 | shikimate transporter | - |
| P8I05_RS11070 | 2301151..2301438 | + | 288 | Protein_2147 | macro domain-containing protein | - |
| P8I05_RS11075 | 2301451..2301962 | + | 512 | Protein_2148 | tail fiber assembly protein | - |
| P8I05_RS11080 | 2302059..2302259 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2291584..2316969 | 25385 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275623 NZ_CP121075:2297284-2297387 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT275623 NZ_CP121075:c2297389-2297246 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
