Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2643255..2643398 | Replicon | chromosome |
| Accession | NZ_CP121073 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R22.2169 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2643257..2643360 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2643255..2643398 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8I07_RS12895 | 2638385..2638585 | + | 201 | Protein_2527 | PagK family vesicle-borne virulence factor | - |
| P8I07_RS12900 | 2638682..2639193 | - | 512 | Protein_2528 | tail fiber assembly protein | - |
| P8I07_RS12905 | 2639206..2639493 | - | 288 | Protein_2529 | macro domain-containing protein | - |
| P8I07_RS12910 | 2639503..2639718 | - | 216 | Protein_2530 | shikimate transporter | - |
| P8I07_RS12915 | 2639720..2639980 | - | 261 | Protein_2531 | DUF1441 family protein | - |
| P8I07_RS12920 | 2640288..2640455 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| P8I07_RS12925 | 2640712..2641245 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P8I07_RS12930 | 2641299..2641490 | - | 192 | Protein_2534 | glycoside hydrolase family 19 protein | - |
| P8I07_RS12935 | 2641479..2641940 | + | 462 | Protein_2535 | DNA breaking-rejoining protein | - |
| P8I07_RS12940 | 2642204..2643097 | + | 894 | Protein_2536 | tyrosine-type recombinase/integrase | - |
| - | 2643255..2643398 | + | 144 | - | - | Antitoxin |
| - | 2643257..2643360 | - | 104 | - | - | Toxin |
| P8I07_RS12945 | 2643500..2643853 | - | 354 | WP_000722368.1 | YebY family protein | - |
| P8I07_RS12950 | 2643870..2644745 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P8I07_RS12955 | 2644746..2645120 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8I07_RS12960 | 2645258..2645488 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8I07_RS12965 | 2645596..2646252 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P8I07_RS12970 | 2646276..2646974 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2623675..2649060 | 25385 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275603 NZ_CP121073:c2643360-2643257 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT275603 NZ_CP121073:2643255-2643398 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
