Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2643789..2643932 | Replicon | chromosome |
| Accession | NZ_CP121070 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R22.0044 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2643791..2643894 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2643789..2643932 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8I10_RS12895 | 2638919..2639119 | + | 201 | Protein_2527 | PagK family vesicle-borne virulence factor | - |
| P8I10_RS12900 | 2639216..2639727 | - | 512 | Protein_2528 | tail fiber assembly protein | - |
| P8I10_RS12905 | 2639740..2640027 | - | 288 | Protein_2529 | macro domain-containing protein | - |
| P8I10_RS12910 | 2640037..2640252 | - | 216 | Protein_2530 | shikimate transporter | - |
| P8I10_RS12915 | 2640254..2640514 | - | 261 | Protein_2531 | DUF1441 family protein | - |
| P8I10_RS12920 | 2640822..2640989 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| P8I10_RS12925 | 2641246..2641779 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P8I10_RS12930 | 2641833..2642024 | - | 192 | Protein_2534 | glycoside hydrolase family 19 protein | - |
| P8I10_RS12935 | 2642013..2642474 | + | 462 | Protein_2535 | DNA breaking-rejoining protein | - |
| P8I10_RS12940 | 2642738..2643631 | + | 894 | Protein_2536 | tyrosine-type recombinase/integrase | - |
| - | 2643789..2643932 | + | 144 | - | - | Antitoxin |
| - | 2643791..2643894 | - | 104 | - | - | Toxin |
| P8I10_RS12945 | 2644034..2644387 | - | 354 | WP_000722368.1 | YebY family protein | - |
| P8I10_RS12950 | 2644404..2645279 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P8I10_RS12955 | 2645280..2645654 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8I10_RS12960 | 2645792..2646022 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8I10_RS12965 | 2646130..2646786 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P8I10_RS12970 | 2646810..2647508 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2624209..2665803 | 41594 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275582 NZ_CP121070:c2643894-2643791 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT275582 NZ_CP121070:2643789-2643932 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
