Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2015148..2015291 | Replicon | chromosome |
| Accession | NZ_CP121066 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R21.0914 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2015186..2015289 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2015148..2015291 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8I09_RS09725 | 2011572..2012270 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
| P8I09_RS09730 | 2012294..2012950 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P8I09_RS09735 | 2013058..2013288 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8I09_RS09740 | 2013426..2013800 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8I09_RS09745 | 2013801..2014676 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P8I09_RS09750 | 2014693..2015046 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2015148..2015291 | - | 144 | - | - | Antitoxin |
| - | 2015186..2015289 | + | 104 | - | - | Toxin |
| P8I09_RS09755 | 2015449..2016342 | - | 894 | Protein_1904 | tyrosine-type recombinase/integrase | - |
| P8I09_RS09760 | 2016606..2017067 | - | 462 | Protein_1905 | DNA breaking-rejoining protein | - |
| P8I09_RS09765 | 2017056..2017247 | + | 192 | Protein_1906 | glycoside hydrolase family 19 protein | - |
| P8I09_RS09770 | 2017301..2017834 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P8I09_RS09775 | 2018091..2018258 | - | 168 | WP_000789529.1 | lytic enzyme | - |
| P8I09_RS09780 | 2018566..2018826 | + | 261 | Protein_1909 | DUF1441 family protein | - |
| P8I09_RS09785 | 2018828..2019043 | + | 216 | Protein_1910 | shikimate transporter | - |
| P8I09_RS09790 | 2019053..2019340 | + | 288 | Protein_1911 | macro domain-containing protein | - |
| P8I09_RS09795 | 2019353..2019864 | + | 512 | Protein_1912 | tail fiber assembly protein | - |
| P8I09_RS09800 | 2019961..2020161 | - | 201 | Protein_1913 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1995148..2047797 | 52649 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275538 NZ_CP121066:2015186-2015289 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT275538 NZ_CP121066:c2015291-2015148 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG