Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2101749..2101894 | Replicon | chromosome |
| Accession | NZ_CP120343 | ||
| Organism | Salmonella enterica subsp. enterica serovar Paratyphi B strain PS_Mu_4_2021 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2101789..2101892 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2101749..2101894 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P1708_RS10355 | 2098175..2098873 | - | 699 | WP_021294108.1 | exodeoxyribonuclease X | - |
| P1708_RS10360 | 2098897..2099553 | - | 657 | WP_021294109.1 | carbon-nitrogen hydrolase family protein | - |
| P1708_RS10365 | 2099661..2099891 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P1708_RS10370 | 2100029..2100403 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P1708_RS10375 | 2100404..2101279 | + | 876 | WP_021294110.1 | copper homeostasis membrane protein CopD | - |
| P1708_RS10380 | 2101296..2101649 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2101749..2101894 | - | 146 | - | - | Antitoxin |
| - | 2101789..2101892 | + | 104 | - | - | Toxin |
| P1708_RS10385 | 2102022..2103101 | - | 1080 | WP_020438172.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| P1708_RS10390 | 2103134..2104284 | - | 1151 | Protein_2032 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| P1708_RS10395 | 2104273..2104464 | + | 192 | Protein_2033 | glycoside hydrolase family 19 protein | - |
| P1708_RS10400 | 2104518..2105051 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| P1708_RS10405 | 2105308..2105475 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| P1708_RS10410 | 2105540..2105728 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| P1708_RS10415 | 2105783..2106043 | + | 261 | Protein_2037 | DUF1441 family protein | - |
| P1708_RS10420 | 2106258..2106620 | + | 363 | Protein_2038 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2096087..2141605 | 45518 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T274818 NZ_CP120343:2101789-2101892 [Salmonella enterica subsp. enterica serovar Paratyphi B]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT274818 NZ_CP120343:c2101894-2101749 [Salmonella enterica subsp. enterica serovar Paratyphi B]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
