Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2487173..2487316 | Replicon | chromosome |
| Accession | NZ_CP119982 | ||
| Organism | Salmonella enterica strain CRIN541822 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2487175..2487278 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2487173..2487316 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P2V99_RS12055 | 2482303..2482503 | + | 201 | Protein_2352 | PagK family vesicle-borne virulence factor | - |
| P2V99_RS12060 | 2482600..2483111 | - | 512 | Protein_2353 | tail fiber assembly protein | - |
| P2V99_RS12065 | 2483124..2483411 | - | 288 | Protein_2354 | macro domain-containing protein | - |
| P2V99_RS12070 | 2483421..2483636 | - | 216 | Protein_2355 | shikimate transporter | - |
| P2V99_RS12075 | 2483638..2483898 | - | 261 | Protein_2356 | DUF1441 family protein | - |
| P2V99_RS12080 | 2484206..2484373 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| P2V99_RS12085 | 2484630..2485163 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P2V99_RS12090 | 2485217..2485408 | - | 192 | Protein_2359 | glycoside hydrolase family 19 protein | - |
| P2V99_RS12095 | 2485397..2485858 | + | 462 | Protein_2360 | DNA breaking-rejoining protein | - |
| P2V99_RS12100 | 2486122..2487015 | + | 894 | Protein_2361 | tyrosine-type recombinase/integrase | - |
| - | 2487173..2487316 | + | 144 | - | - | Antitoxin |
| - | 2487175..2487278 | - | 104 | - | - | Toxin |
| P2V99_RS12105 | 2487418..2487771 | - | 354 | WP_000722368.1 | YebY family protein | - |
| P2V99_RS12110 | 2487788..2488663 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P2V99_RS12115 | 2488664..2489038 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P2V99_RS12120 | 2489176..2489406 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P2V99_RS12125 | 2489514..2490170 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P2V99_RS12130 | 2490194..2490892 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2467593..2492978 | 25385 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T274520 NZ_CP119982:c2487278-2487175 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT274520 NZ_CP119982:2487173-2487316 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
