Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1984723..1984866 | Replicon | chromosome |
| Accession | NZ_CP119137 | ||
| Organism | Salmonella enterica subsp. enterica serovar Goldcoast isolate Sal02792 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1984761..1984864 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1984723..1984866 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P0D85_RS10660 | 1981147..1981845 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| P0D85_RS10665 | 1981869..1982525 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P0D85_RS10670 | 1982633..1982863 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P0D85_RS10675 | 1983001..1983375 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| P0D85_RS10680 | 1983376..1984251 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| P0D85_RS10685 | 1984268..1984621 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 1984723..1984866 | - | 144 | - | - | Antitoxin |
| - | 1984761..1984864 | + | 104 | - | - | Toxin |
| P0D85_RS10690 | 1984995..1985645 | - | 651 | Protein_1842 | tyrosine-type recombinase/integrase | - |
| P0D85_RS10695 | 1985656..1985961 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| P0D85_RS10700 | 1985918..1986121 | + | 204 | Protein_1844 | phage tail protein | - |
| P0D85_RS10705 | 1986293..1986448 | + | 156 | Protein_1845 | phage tail protein | - |
| P0D85_RS10710 | 1986554..1986886 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| P0D85_RS10715 | 1986935..1987044 | + | 110 | Protein_1847 | tail fiber assembly protein | - |
| P0D85_RS10720 | 1987135..1987320 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| P0D85_RS10725 | 1987572..1987760 | - | 189 | Protein_1849 | tail fiber assembly protein | - |
| P0D85_RS10730 | 1987756..1988526 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| P0D85_RS10735 | 1989017..1989145 | + | 129 | Protein_1851 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1962851..2015832 | 52981 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T273822 NZ_CP119137:1984761-1984864 [Salmonella enterica subsp. enterica serovar Goldcoast]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT273822 NZ_CP119137:c1984866-1984723 [Salmonella enterica subsp. enterica serovar Goldcoast]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
