Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1929040..1929180 | Replicon | chromosome |
Accession | NZ_CP118723 | ||
Organism | Serratia marcescens strain AHRB3 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1929084..1929180 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1929040..1929180 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PWO23_RS09250 (PWO23_09255) | 1924307..1924702 | + | 396 | WP_048322942.1 | RidA family protein | - |
PWO23_RS09255 (PWO23_09260) | 1924859..1925812 | + | 954 | WP_004928848.1 | prolyl aminopeptidase | - |
PWO23_RS09260 (PWO23_09265) | 1925845..1926075 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
PWO23_RS09265 (PWO23_09270) | 1926420..1926938 | + | 519 | WP_274985369.1 | non-heme ferritin | - |
PWO23_RS09270 (PWO23_09275) | 1927231..1927647 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
PWO23_RS09275 (PWO23_09280) | 1927650..1928531 | + | 882 | WP_131164343.1 | copper homeostasis membrane protein CopD | - |
PWO23_RS09280 (PWO23_09285) | 1928601..1928942 | + | 342 | WP_016928154.1 | YebY family protein | - |
- | 1929040..1929180 | - | 141 | - | - | Antitoxin |
- | 1929084..1929180 | + | 97 | - | - | Toxin |
PWO23_RS09285 (PWO23_09290) | 1929270..1929932 | - | 663 | Protein_1785 | tyrosine-type recombinase/integrase | - |
PWO23_RS09290 (PWO23_09295) | 1931495..1931812 | + | 318 | WP_274985370.1 | phage holin family protein | - |
PWO23_RS09295 (PWO23_09300) | 1931799..1932239 | + | 441 | WP_274985371.1 | lysozyme | - |
PWO23_RS09300 (PWO23_09305) | 1932236..1932619 | + | 384 | WP_274985372.1 | hypothetical protein | - |
PWO23_RS09305 (PWO23_09310) | 1932519..1932776 | + | 258 | WP_274985373.1 | Rz1-like lysis system protein LysC | - |
PWO23_RS09310 (PWO23_09315) | 1932766..1932936 | + | 171 | WP_154640827.1 | hypothetical protein | - |
PWO23_RS09315 (PWO23_09320) | 1932988..1933533 | - | 546 | WP_274985374.1 | hypothetical protein | - |
PWO23_RS09320 (PWO23_09325) | 1933923..1934123 | + | 201 | Protein_1792 | glycoside hydrolase family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T273387 NZ_CP118723:1929084-1929180 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT273387 NZ_CP118723:c1929180-1929040 [Serratia marcescens]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG