Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2126039..2126184 | Replicon | chromosome |
| Accession | NZ_CP118633 | ||
| Organism | Salmonella enterica subsp. enterica serovar Anatum strain 2089b | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2126079..2126182 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2126039..2126184 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PWO88_RS10380 | 2122465..2123163 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| PWO88_RS10385 | 2123187..2123843 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| PWO88_RS10390 | 2123951..2124181 | - | 231 | WP_080155354.1 | DNA polymerase III subunit theta | - |
| PWO88_RS10395 | 2124319..2124693 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PWO88_RS10400 | 2124694..2125569 | + | 876 | WP_072101102.1 | copper homeostasis membrane protein CopD | - |
| PWO88_RS10405 | 2125586..2125939 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2126039..2126184 | - | 146 | - | - | Antitoxin |
| - | 2126079..2126182 | + | 104 | - | - | Toxin |
| PWO88_RS10410 | 2126311..2127390 | - | 1080 | WP_020438172.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PWO88_RS10415 | 2127423..2128574 | - | 1152 | Protein_2037 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PWO88_RS10420 | 2128563..2128754 | + | 192 | Protein_2038 | glycoside hydrolase family 19 protein | - |
| PWO88_RS10425 | 2128808..2129341 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| PWO88_RS10430 | 2129598..2129765 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PWO88_RS10435 | 2129830..2130018 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PWO88_RS10440 | 2130073..2130564 | + | 492 | WP_000348541.1 | DUF1441 family protein | - |
| PWO88_RS10445 | 2130551..2131118 | + | 568 | Protein_2043 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2106041..2161118 | 55077 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T273337 NZ_CP118633:2126079-2126182 [Salmonella enterica subsp. enterica serovar Anatum]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT273337 NZ_CP118633:c2126184-2126039 [Salmonella enterica subsp. enterica serovar Anatum]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG