Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2784002..2784145 | Replicon | chromosome |
Accession | NZ_CP118537 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain S3 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2784004..2784106 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2784002..2784145 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
O1A30_RS13935 (O1A30_13935) | 2781280..2782410 | + | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
O1A30_RS13940 (O1A30_13940) | 2782696..2783091 | - | 396 | Protein_2731 | DUF977 family protein | - |
O1A30_RS13945 (O1A30_13945) | 2783104..2783214 | - | 111 | Protein_2732 | replication protein | - |
O1A30_RS13950 (O1A30_13950) | 2783215..2783576 | + | 362 | Protein_2733 | recombinase RecT | - |
O1A30_RS13955 (O1A30_13955) | 2783575..2783883 | + | 309 | Protein_2734 | tyrosine-type recombinase/integrase | - |
- | 2784002..2784145 | + | 144 | - | - | Antitoxin |
- | 2784004..2784106 | - | 103 | - | - | Toxin |
O1A30_RS13960 (O1A30_13960) | 2784247..2784600 | - | 354 | WP_000722366.1 | YebY family protein | - |
O1A30_RS13965 (O1A30_13965) | 2784617..2785492 | - | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
O1A30_RS13970 (O1A30_13970) | 2785493..2785867 | - | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
O1A30_RS13975 (O1A30_13975) | 2786005..2786235 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
O1A30_RS13980 (O1A30_13980) | 2786343..2786999 | + | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
O1A30_RS13985 (O1A30_13985) | 2787023..2787721 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 2760462..2806018 | 45556 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T273169 NZ_CP118537:c2784106-2784004 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT273169 NZ_CP118537:2784002-2784145 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG