Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 3191204..3191347 | Replicon | chromosome |
| Accession | NZ_CP117976 | ||
| Organism | Salmonella enterica strain B-4212 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 3191206..3191309 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 3191204..3191347 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PT747_RS15505 | 3186925..3187053 | - | 129 | Protein_3021 | helix-turn-helix domain-containing protein | - |
| PT747_RS15510 | 3187544..3188313 | + | 770 | Protein_3022 | transporter substrate-binding domain-containing protein | - |
| PT747_RS15515 | 3188411..3188506 | + | 96 | WP_024133706.1 | hypothetical protein | - |
| PT747_RS15520 | 3188750..3188935 | + | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| PT747_RS15525 | 3189026..3189135 | - | 110 | Protein_3025 | tail fiber assembly protein | - |
| PT747_RS15530 | 3189184..3189516 | - | 333 | WP_031606598.1 | DUF1353 domain-containing protein | - |
| PT747_RS15535 | 3189622..3189777 | - | 156 | Protein_3027 | phage tail protein | - |
| PT747_RS15540 | 3189949..3190155 | - | 207 | Protein_3028 | phage tail protein | - |
| PT747_RS15545 | 3190109..3190402 | - | 294 | WP_001540231.1 | hypothetical protein | - |
| PT747_RS15550 | 3190425..3191075 | + | 651 | Protein_3030 | tyrosine-type recombinase/integrase | - |
| - | 3191204..3191347 | + | 144 | - | - | Antitoxin |
| - | 3191206..3191309 | - | 104 | - | - | Toxin |
| PT747_RS15555 | 3191449..3191802 | - | 354 | WP_000722368.1 | YebY family protein | - |
| PT747_RS15560 | 3191819..3192694 | - | 876 | WP_001540235.1 | copper homeostasis membrane protein CopD | - |
| PT747_RS15565 | 3192695..3193069 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PT747_RS15570 | 3193207..3193437 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PT747_RS15575 | 3193545..3194201 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| PT747_RS15580 | 3194225..3194923 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 3189184..3197009 | 7825 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T272626 NZ_CP117976:c3191309-3191206 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT272626 NZ_CP117976:3191204-3191347 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
