Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2832839..2832982 | Replicon | chromosome |
Accession | NZ_CP117838 | ||
Organism | Enterobacter sp. S-33 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2832844..2832947 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2832839..2832982 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PUP35_RS13420 | 2828147..2828434 | + | 288 | WP_274240163.1 | hypothetical protein | - |
PUP35_RS13425 | 2828397..2828789 | + | 393 | WP_274240164.1 | DUF551 domain-containing protein | - |
PUP35_RS13430 | 2828853..2829140 | + | 288 | WP_274240165.1 | excisionase | - |
PUP35_RS13435 | 2829094..2830161 | + | 1068 | WP_274240166.1 | phage integrase Arm DNA-binding domain-containing protein | - |
PUP35_RS13440 | 2830196..2831083 | - | 888 | WP_274240167.1 | hypothetical protein | - |
PUP35_RS13445 | 2831083..2831505 | - | 423 | WP_274240168.1 | hypothetical protein | - |
PUP35_RS13450 | 2831507..2832586 | - | 1080 | WP_274240170.1 | hypothetical protein | - |
- | 2832839..2832982 | + | 144 | - | - | Antitoxin |
- | 2832844..2832947 | - | 104 | - | - | Toxin |
PUP35_RS13455 | 2833086..2833424 | - | 339 | WP_111964807.1 | YebY family protein | - |
PUP35_RS13460 | 2833441..2834310 | - | 870 | WP_274240172.1 | copper homeostasis membrane protein CopD | - |
PUP35_RS13465 | 2834312..2834683 | - | 372 | WP_274240174.1 | CopC domain-containing protein YobA | - |
PUP35_RS13470 | 2834821..2835051 | + | 231 | WP_008500465.1 | DNA polymerase III subunit theta | - |
PUP35_RS13475 | 2835162..2835812 | + | 651 | WP_274240177.1 | carbon-nitrogen hydrolase family protein | - |
PUP35_RS13480 | 2835837..2836499 | + | 663 | WP_115875682.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2774336..2853794 | 79458 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T272332 NZ_CP117838:c2832947-2832844 [Enterobacter sp. S-33]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT272332 NZ_CP117838:2832839-2832982 [Enterobacter sp. S-33]
CAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
CAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT