Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1955895..1956038 | Replicon | chromosome |
Accession | NZ_CP117698 | ||
Organism | Salmonella enterica subsp. enterica serovar London strain L1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1955934..1956036 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1955895..1956038 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PRJ38_RS09315 | 1952319..1953017 | - | 699 | WP_023255939.1 | exodeoxyribonuclease X | - |
PRJ38_RS09320 | 1953041..1953697 | - | 657 | WP_023245437.1 | carbon-nitrogen hydrolase family protein | - |
PRJ38_RS09325 | 1953805..1954035 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PRJ38_RS09330 | 1954173..1954547 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PRJ38_RS09335 | 1954548..1955423 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
PRJ38_RS09340 | 1955440..1955793 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 1955895..1956038 | - | 144 | - | - | Antitoxin |
- | 1955934..1956036 | + | 103 | - | - | Toxin |
PRJ38_RS09345 | 1956176..1957255 | - | 1080 | WP_058107134.1 | phage integrase Arm DNA-binding domain-containing protein | - |
PRJ38_RS09350 | 1957288..1958439 | - | 1152 | Protein_1825 | PD-(D/E)XK nuclease-like domain-containing protein | - |
PRJ38_RS09355 | 1958428..1958619 | + | 192 | Protein_1826 | glycoside hydrolase family 19 protein | - |
PRJ38_RS09360 | 1958673..1959206 | + | 534 | WP_023256014.1 | DUF2514 domain-containing protein | - |
PRJ38_RS09365 | 1959463..1959630 | - | 168 | WP_000789530.1 | lytic enzyme | - |
PRJ38_RS09370 | 1959695..1959883 | - | 189 | WP_001034748.1 | hypothetical protein | - |
PRJ38_RS09375 | 1959938..1960198 | + | 261 | Protein_1830 | DUF1441 family protein | - |
PRJ38_RS09380 | 1960200..1960415 | + | 216 | Protein_1831 | shikimate transporter | - |
PRJ38_RS09385 | 1960425..1960712 | + | 288 | Protein_1832 | macro domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1932708..1976207 | 43499 | |
- | inside | Prophage | - | sopE2 | 1932708..1989132 | 56424 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T272061 NZ_CP117698:1955934-1956036 [Salmonella enterica subsp. enterica serovar London]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT272061 NZ_CP117698:c1956038-1955895 [Salmonella enterica subsp. enterica serovar London]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG