Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1961032..1961175 | Replicon | chromosome |
Accession | NZ_CP117402 | ||
Organism | Salmonella enterica subsp. enterica serovar Give strain RM007 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1961070..1961173 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1961032..1961175 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQQ13_RS09425 | 1957455..1958153 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
PQQ13_RS09430 | 1958177..1958833 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
PQQ13_RS09435 | 1958941..1959171 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQQ13_RS09440 | 1959309..1959683 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQQ13_RS09445 | 1959684..1960559 | + | 876 | WP_000979695.1 | copper homeostasis membrane protein CopD | - |
PQQ13_RS09450 | 1960576..1960929 | + | 354 | WP_017441954.1 | YebY family protein | - |
- | 1961032..1961175 | - | 144 | - | - | Antitoxin |
- | 1961070..1961173 | + | 104 | - | - | Toxin |
PQQ13_RS09455 | 1961304..1962383 | - | 1080 | WP_000087641.1 | phage integrase Arm DNA-binding domain-containing protein | - |
PQQ13_RS09460 | 1962416..1963564 | - | 1149 | Protein_1847 | PD-(D/E)XK nuclease-like domain-containing protein | - |
PQQ13_RS09465 | 1963556..1963804 | + | 249 | Protein_1848 | glycoside hydrolase family 19 protein | - |
PQQ13_RS09470 | 1963801..1964333 | + | 533 | Protein_1849 | DUF2514 domain-containing protein | - |
PQQ13_RS09475 | 1964590..1964757 | - | 168 | WP_000789530.1 | lytic enzyme | - |
PQQ13_RS09480 | 1965060..1965551 | + | 492 | WP_000348547.1 | DUF1441 family protein | - |
PQQ13_RS09485 | 1965538..1966105 | + | 568 | Protein_1852 | phage terminase large subunit family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1955367..1994164 | 38797 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T271179 NZ_CP117402:1961070-1961173 [Salmonella enterica subsp. enterica serovar Give]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT271179 NZ_CP117402:c1961175-1961032 [Salmonella enterica subsp. enterica serovar Give]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG