Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2019362..2019505 | Replicon | chromosome |
| Accession | NZ_CP117396 | ||
| Organism | Salmonella enterica subsp. enterica serovar Uganda strain RM016 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2019400..2019503 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2019362..2019505 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP86_RS09735 | 2015786..2016484 | - | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
| PQP86_RS09740 | 2016508..2017164 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| PQP86_RS09745 | 2017272..2017502 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP86_RS09750 | 2017640..2018014 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PQP86_RS09755 | 2018015..2018890 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| PQP86_RS09760 | 2018907..2019260 | + | 354 | WP_000722370.1 | YebY family protein | - |
| - | 2019362..2019505 | - | 144 | - | - | Antitoxin |
| - | 2019400..2019503 | + | 104 | - | - | Toxin |
| PQP86_RS09765 | 2019633..2020474 | - | 842 | Protein_1906 | tyrosine-type recombinase/integrase | - |
| PQP86_RS09770 | 2020565..2020921 | + | 357 | WP_000003145.1 | hypothetical protein | - |
| PQP86_RS09775 | 2020875..2021081 | + | 207 | Protein_1908 | phage tail protein | - |
| PQP86_RS09780 | 2021253..2021408 | + | 156 | Protein_1909 | phage tail protein | - |
| PQP86_RS09785 | 2021514..2021846 | + | 333 | WP_031609875.1 | DUF1353 domain-containing protein | - |
| PQP86_RS09790 | 2021895..2022004 | + | 110 | Protein_1911 | tail fiber assembly protein | - |
| PQP86_RS09795 | 2022095..2022280 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| PQP86_RS09800 | 2022523..2022720 | - | 198 | Protein_1913 | tail fiber assembly protein | - |
| PQP86_RS09805 | 2022716..2023486 | - | 771 | WP_001652627.1 | transporter substrate-binding domain-containing protein | - |
| PQP86_RS09810 | 2023977..2024105 | + | 129 | Protein_1915 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2013700..2045928 | 32228 | |
| - | inside | Prophage | - | sopE2 | 2012023..2058853 | 46830 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T271120 NZ_CP117396:2019400-2019503 [Salmonella enterica subsp. enterica serovar Uganda]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT271120 NZ_CP117396:c2019505-2019362 [Salmonella enterica subsp. enterica serovar Uganda]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
