Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2473720..2473863 | Replicon | chromosome |
| Accession | NZ_CP117386 | ||
| Organism | Salmonella enterica subsp. enterica serovar Uganda strain RM011 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2473722..2473825 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2473720..2473863 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP90_RS12075 | 2469108..2469248 | - | 141 | Protein_2364 | helix-turn-helix domain-containing protein | - |
| PQP90_RS12080 | 2469739..2470509 | + | 771 | WP_001652627.1 | transporter substrate-binding domain-containing protein | - |
| PQP90_RS12085 | 2470505..2470702 | + | 198 | Protein_2366 | tail fiber assembly protein | - |
| PQP90_RS12090 | 2470945..2471130 | + | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| PQP90_RS12095 | 2471221..2471330 | - | 110 | Protein_2368 | tail fiber assembly protein | - |
| PQP90_RS12100 | 2471379..2471711 | - | 333 | WP_031609875.1 | DUF1353 domain-containing protein | - |
| PQP90_RS12105 | 2471817..2471972 | - | 156 | Protein_2370 | phage tail protein | - |
| PQP90_RS12110 | 2472144..2472350 | - | 207 | Protein_2371 | phage tail protein | - |
| PQP90_RS12115 | 2472304..2472660 | - | 357 | WP_000003145.1 | hypothetical protein | - |
| PQP90_RS12120 | 2472751..2473592 | + | 842 | Protein_2373 | tyrosine-type recombinase/integrase | - |
| - | 2473720..2473863 | + | 144 | - | - | Antitoxin |
| - | 2473722..2473825 | - | 104 | - | - | Toxin |
| PQP90_RS12125 | 2473965..2474318 | - | 354 | WP_000722370.1 | YebY family protein | - |
| PQP90_RS12130 | 2474335..2475210 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| PQP90_RS12135 | 2475211..2475585 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PQP90_RS12140 | 2475723..2475953 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP90_RS12145 | 2476061..2476717 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| PQP90_RS12150 | 2476741..2477439 | + | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2447296..2495733 | 48437 | |
| - | inside | Prophage | - | sopE2 | 2434371..2495733 | 61362 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T271019 NZ_CP117386:c2473825-2473722 [Salmonella enterica subsp. enterica serovar Uganda]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT271019 NZ_CP117386:2473720-2473863 [Salmonella enterica subsp. enterica serovar Uganda]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
