Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2019187..2019330 | Replicon | chromosome |
| Accession | NZ_CP117382 | ||
| Organism | Salmonella enterica subsp. enterica serovar Uganda strain RM018 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2019225..2019328 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2019187..2019330 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP98_RS09725 | 2015611..2016309 | - | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
| PQP98_RS09730 | 2016333..2016989 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| PQP98_RS09735 | 2017097..2017327 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP98_RS09740 | 2017465..2017839 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PQP98_RS09745 | 2017840..2018715 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| PQP98_RS09750 | 2018732..2019085 | + | 354 | WP_000722370.1 | YebY family protein | - |
| - | 2019187..2019330 | - | 144 | - | - | Antitoxin |
| - | 2019225..2019328 | + | 104 | - | - | Toxin |
| PQP98_RS09755 | 2019458..2020299 | - | 842 | Protein_1904 | tyrosine-type recombinase/integrase | - |
| PQP98_RS09760 | 2020390..2020746 | + | 357 | WP_000003145.1 | hypothetical protein | - |
| PQP98_RS09765 | 2020700..2020906 | + | 207 | Protein_1906 | phage tail protein | - |
| PQP98_RS09770 | 2021078..2021233 | + | 156 | Protein_1907 | phage tail protein | - |
| PQP98_RS09775 | 2021339..2021671 | + | 333 | WP_031609875.1 | DUF1353 domain-containing protein | - |
| PQP98_RS09780 | 2021720..2021829 | + | 110 | Protein_1909 | tail fiber assembly protein | - |
| PQP98_RS09785 | 2021920..2022105 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| PQP98_RS09790 | 2022348..2022545 | - | 198 | Protein_1911 | tail fiber assembly protein | - |
| PQP98_RS09795 | 2022541..2023311 | - | 771 | WP_001652627.1 | transporter substrate-binding domain-containing protein | - |
| PQP98_RS09800 | 2023802..2023930 | + | 129 | Protein_1913 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2013525..2045753 | 32228 | |
| - | inside | Prophage | - | sopE2 | 2011848..2048362 | 36514 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270975 NZ_CP117382:2019225-2019328 [Salmonella enterica subsp. enterica serovar Uganda]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270975 NZ_CP117382:c2019330-2019187 [Salmonella enterica subsp. enterica serovar Uganda]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
