Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2162264..2162409 | Replicon | chromosome |
| Accession | NZ_CP117380 | ||
| Organism | Salmonella enterica subsp. enterica serovar Newport strain RM037 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2162266..2162369 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2162264..2162409 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP93_RS10835 | 2157554..2157898 | - | 345 | Protein_2123 | macro domain-containing protein | - |
| PQP93_RS10840 | 2158113..2158373 | - | 261 | Protein_2124 | DUF1441 family protein | - |
| PQP93_RS10845 | 2158428..2158616 | + | 189 | WP_274890301.1 | hypothetical protein | - |
| PQP93_RS10850 | 2158681..2158848 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| PQP93_RS10855 | 2159105..2159639 | - | 535 | Protein_2127 | DUF2514 domain-containing protein | - |
| PQP93_RS10860 | 2159636..2159884 | - | 249 | Protein_2128 | glycoside hydrolase family 19 protein | - |
| PQP93_RS10865 | 2160032..2161027 | + | 996 | Protein_2129 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PQP93_RS10870 | 2161057..2162136 | + | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2162264..2162409 | + | 146 | - | - | Antitoxin |
| - | 2162266..2162369 | - | 104 | - | - | Toxin |
| PQP93_RS10875 | 2162509..2162862 | - | 354 | WP_000722368.1 | YebY family protein | - |
| PQP93_RS10880 | 2162879..2163754 | - | 876 | WP_000979684.1 | copper homeostasis membrane protein CopD | - |
| PQP93_RS10885 | 2163755..2164129 | - | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| PQP93_RS10890 | 2164267..2164497 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP93_RS10895 | 2164605..2165261 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| PQP93_RS10900 | 2165285..2165983 | + | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2130162..2168071 | 37909 | |
| - | inside | Prophage | - | sopE2 | 2122509..2184280 | 61771 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270959 NZ_CP117380:c2162369-2162266 [Salmonella enterica subsp. enterica serovar Newport]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270959 NZ_CP117380:2162264-2162409 [Salmonella enterica subsp. enterica serovar Newport]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG