Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2045455..2045600 | Replicon | chromosome |
| Accession | NZ_CP117378 | ||
| Organism | Salmonella enterica subsp. enterica serovar Newport strain RM038 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2045495..2045598 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2045455..2045600 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP81_RS09890 | 2041881..2042579 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| PQP81_RS09895 | 2042603..2043259 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| PQP81_RS09900 | 2043367..2043597 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQP81_RS09905 | 2043735..2044109 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| PQP81_RS09910 | 2044110..2044985 | + | 876 | WP_000979684.1 | copper homeostasis membrane protein CopD | - |
| PQP81_RS09915 | 2045002..2045355 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2045455..2045600 | - | 146 | - | - | Antitoxin |
| - | 2045495..2045598 | + | 104 | - | - | Toxin |
| PQP81_RS09920 | 2045728..2046807 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PQP81_RS09925 | 2046837..2047832 | - | 996 | Protein_1938 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PQP81_RS09930 | 2047980..2048228 | + | 249 | Protein_1939 | glycoside hydrolase family 19 protein | - |
| PQP81_RS09935 | 2048225..2048759 | + | 535 | Protein_1940 | DUF2514 domain-containing protein | - |
| PQP81_RS09940 | 2049016..2049183 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQP81_RS09945 | 2049248..2049436 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PQP81_RS09950 | 2049490..2049750 | + | 261 | Protein_1943 | DUF1441 family protein | - |
| PQP81_RS09955 | 2049965..2050309 | + | 345 | Protein_1944 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2025455..2085354 | 59899 | |
| - | inside | Prophage | - | sopE2 | 2023584..2085354 | 61770 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270943 NZ_CP117378:2045495-2045598 [Salmonella enterica subsp. enterica serovar Newport]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270943 NZ_CP117378:c2045600-2045455 [Salmonella enterica subsp. enterica serovar Newport]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
