Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2725706..2725851 | Replicon | chromosome |
Accession | NZ_CP117343 | ||
Organism | Salmonella enterica subsp. enterica serovar Dublin strain RM105 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2725708..2725811 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2725706..2725851 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQP76_RS13480 | 2722586..2723416 | + | 831 | WP_024139186.1 | recombination protein RecT | - |
PQP76_RS13485 | 2723463..2723648 | + | 186 | WP_000280163.1 | DUF1187 family protein | - |
PQP76_RS13490 | 2723747..2724175 | + | 429 | WP_000743301.1 | hypothetical protein | - |
PQP76_RS13495 | 2724236..2724514 | + | 279 | WP_001675651.1 | excisionase | - |
PQP76_RS13500 | 2724489..2725568 | + | 1080 | WP_000087638.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2725706..2725851 | + | 146 | - | - | Antitoxin |
- | 2725708..2725811 | - | 104 | - | - | Toxin |
PQP76_RS13505 | 2725951..2726304 | - | 354 | WP_000722368.1 | YebY family protein | - |
PQP76_RS13510 | 2726321..2727196 | - | 876 | WP_000979703.1 | copper homeostasis membrane protein CopD | - |
PQP76_RS13515 | 2727197..2727571 | - | 375 | WP_001751617.1 | CopC domain-containing protein YobA | - |
PQP76_RS13520 | 2727709..2727939 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQP76_RS13525 | 2728047..2728703 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
PQP76_RS13530 | 2728727..2729425 | + | 699 | WP_274881929.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2644822..2747721 | 102899 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270655 NZ_CP117343:c2725811-2725708 [Salmonella enterica subsp. enterica serovar Dublin]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270655 NZ_CP117343:2725706-2725851 [Salmonella enterica subsp. enterica serovar Dublin]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG