Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2009366..2009509 | Replicon | chromosome |
| Accession | NZ_CP117332 | ||
| Organism | Salmonella enterica subsp. enterica serovar Muenster strain RM055 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2009404..2009507 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2009366..2009509 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP79_RS09640 | 2005790..2006488 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| PQP79_RS09645 | 2006512..2007168 | - | 657 | WP_274881540.1 | carbon-nitrogen hydrolase family protein | - |
| PQP79_RS09650 | 2007276..2007506 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| PQP79_RS09655 | 2007644..2008018 | + | 375 | WP_001633679.1 | CopC domain-containing protein YobA | - |
| PQP79_RS09660 | 2008019..2008894 | + | 876 | WP_001633680.1 | copper homeostasis membrane protein CopD | - |
| PQP79_RS09665 | 2008911..2009264 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2009366..2009509 | - | 144 | - | - | Antitoxin |
| - | 2009404..2009507 | + | 104 | - | - | Toxin |
| PQP79_RS09670 | 2009638..2010717 | - | 1080 | WP_023137474.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PQP79_RS09675 | 2010750..2011898 | - | 1149 | Protein_1889 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PQP79_RS09680 | 2011890..2012138 | + | 249 | Protein_1890 | glycoside hydrolase family 19 protein | - |
| PQP79_RS09685 | 2012135..2012668 | + | 534 | WP_001633683.1 | DUF2514 domain-containing protein | - |
| PQP79_RS09690 | 2012925..2013092 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQP79_RS09695 | 2013157..2013342 | - | 186 | WP_000981277.1 | hypothetical protein | - |
| PQP79_RS09700 | 2013394..2013885 | + | 492 | WP_000348550.1 | DUF1441 family protein | - |
| PQP79_RS09705 | 2013872..2014439 | + | 568 | Protein_1895 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2003702..2043477 | 39775 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270566 NZ_CP117332:2009404-2009507 [Salmonella enterica subsp. enterica serovar Muenster]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270566 NZ_CP117332:c2009509-2009366 [Salmonella enterica subsp. enterica serovar Muenster]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
