Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2059429..2059572 | Replicon | chromosome |
| Accession | NZ_CP117329 | ||
| Organism | Salmonella enterica subsp. enterica serovar Muenster strain RM074 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2059467..2059570 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2059429..2059572 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQP80_RS10045 | 2055853..2056551 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| PQP80_RS10050 | 2056575..2057231 | - | 657 | WP_274880532.1 | carbon-nitrogen hydrolase family protein | - |
| PQP80_RS10055 | 2057339..2057569 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| PQP80_RS10060 | 2057707..2058081 | + | 375 | WP_001633679.1 | CopC domain-containing protein YobA | - |
| PQP80_RS10065 | 2058082..2058957 | + | 876 | WP_001633680.1 | copper homeostasis membrane protein CopD | - |
| PQP80_RS10070 | 2058974..2059327 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2059429..2059572 | - | 144 | - | - | Antitoxin |
| - | 2059467..2059570 | + | 104 | - | - | Toxin |
| PQP80_RS10075 | 2059701..2060780 | - | 1080 | WP_023137474.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PQP80_RS10080 | 2060813..2061961 | - | 1149 | Protein_1970 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PQP80_RS10085 | 2061953..2062201 | + | 249 | Protein_1971 | glycoside hydrolase family 19 protein | - |
| PQP80_RS10090 | 2062198..2062731 | + | 534 | WP_001633683.1 | DUF2514 domain-containing protein | - |
| PQP80_RS10095 | 2062988..2063155 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQP80_RS10100 | 2063220..2063405 | - | 186 | WP_000981277.1 | hypothetical protein | - |
| PQP80_RS10105 | 2063457..2063948 | + | 492 | WP_000348550.1 | DUF1441 family protein | - |
| PQP80_RS10110 | 2063935..2064502 | + | 568 | Protein_1976 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2053765..2093540 | 39775 | |
| - | inside | Prophage | - | sopE2 | 2037558..2093540 | 55982 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270549 NZ_CP117329:2059467-2059570 [Salmonella enterica subsp. enterica serovar Muenster]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270549 NZ_CP117329:c2059572-2059429 [Salmonella enterica subsp. enterica serovar Muenster]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG