Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2022351..2022496 | Replicon | chromosome |
| Accession | NZ_CP117326 | ||
| Organism | Salmonella enterica subsp. enterica serovar Newport strain RM108 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2022391..2022494 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2022351..2022496 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQQ05_RS09725 | 2018777..2019475 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| PQQ05_RS09730 | 2019526..2020155 | - | 630 | WP_274895574.1 | carbon-nitrogen hydrolase family protein | - |
| PQQ05_RS09735 | 2020263..2020493 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQQ05_RS09740 | 2020631..2021005 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| PQQ05_RS09745 | 2021006..2021881 | + | 876 | WP_000979686.1 | copper homeostasis membrane protein CopD | - |
| PQQ05_RS09750 | 2021898..2022251 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2022351..2022496 | - | 146 | - | - | Antitoxin |
| - | 2022391..2022494 | + | 104 | - | - | Toxin |
| PQQ05_RS09755 | 2022624..2023703 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PQQ05_RS09760 | 2023733..2024728 | - | 996 | Protein_1905 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PQQ05_RS09765 | 2024876..2025124 | + | 249 | Protein_1906 | glycoside hydrolase family 19 protein | - |
| PQQ05_RS09770 | 2025121..2025655 | + | 535 | Protein_1907 | DUF2514 domain-containing protein | - |
| PQQ05_RS09775 | 2025912..2026079 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQQ05_RS09780 | 2026144..2026332 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PQQ05_RS09785 | 2026387..2026647 | + | 261 | Protein_1910 | DUF1441 family protein | - |
| PQQ05_RS09790 | 2026862..2027206 | + | 345 | Protein_1911 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2016689..2062252 | 45563 | |
| - | inside | Prophage | - | sopE2 | 2000480..2062252 | 61772 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270510 NZ_CP117326:2022391-2022494 [Salmonella enterica subsp. enterica serovar Newport]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270510 NZ_CP117326:c2022496-2022351 [Salmonella enterica subsp. enterica serovar Newport]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG