Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2853314..2853457 | Replicon | chromosome |
Accession | NZ_CP117312 | ||
Organism | Salmonella enterica subsp. enterica serovar Derby strain RM003 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2853352..2853455 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2853314..2853457 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQP99_RS13730 | 2849738..2850436 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
PQP99_RS13735 | 2850460..2851116 | - | 657 | WP_274878215.1 | carbon-nitrogen hydrolase family protein | - |
PQP99_RS13740 | 2851224..2851454 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQP99_RS13745 | 2851592..2851966 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQP99_RS13750 | 2851967..2852842 | + | 876 | WP_072103686.1 | copper homeostasis membrane protein CopD | - |
PQP99_RS13755 | 2852859..2853212 | + | 354 | WP_023232537.1 | YebY family protein | - |
- | 2853314..2853457 | - | 144 | - | - | Antitoxin |
- | 2853352..2853455 | + | 104 | - | - | Toxin |
PQP99_RS13760 | 2853586..2853855 | - | 270 | WP_017441955.1 | tyrosine-type recombinase/integrase | - |
PQP99_RS13765 | 2853944..2854027 | + | 84 | Protein_2692 | phage tail protein | - |
PQP99_RS13770 | 2854200..2856620 | + | 2421 | WP_048348800.1 | type III secretion system effector SspH3 | - |
PQP99_RS13775 | 2856645..2856755 | + | 111 | Protein_2694 | DUF4113 domain-containing protein | - |
PQP99_RS13780 | 2856762..2857289 | + | 528 | Protein_2695 | transposase | - |
PQP99_RS13785 | 2857435..2857575 | - | 141 | WP_048348799.1 | hypothetical protein | - |
PQP99_RS13790 | 2857741..2858010 | - | 270 | WP_077248370.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270462 NZ_CP117312:2853352-2853455 [Salmonella enterica subsp. enterica serovar Derby]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270462 NZ_CP117312:c2853457-2853314 [Salmonella enterica subsp. enterica serovar Derby]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG